Have questions? Visit https://www.reddit.com/r/SNPedia

ClinVar/Reports

From SNPedia


Name Significance Disease Normal S M R Risk S M R
Rs1008642 255 Distal myopathy, Tateyama type, not provided, not specified Rs1008642(C;C) common in clinvar 0 Good Rs1008642(G,T;G,T)
Rs1021737 255 Homocysteine, total plasma, elevated Rs1021737(G;G) common in clinvar 0 Good Rs1021737(T;T) significantly higher plasma total homocysteine concentration 3 Bad
Rs1024611 255 Spina bifida, susceptibility to, Coronary artery disease, modifier of, Coronary artery disease, development of, in hiv, Mycobacterium tuberculosis, susceptibility to Rs1024611(T;T) normal risk 0 Good Rs1024611(C;C) increased risk of exercise induced ischemia, Increased CCL2 levels; increased rate of HIV progression 2.2 Bad
Rs1041981 255 Myocardial infarction Rs1041981(C;C) normal Rs1041981(A;A) Higher myocardial infarction risk 2 Bad
Rs1042602 255 Skin/hair/eye pigmentation, variation in, 3, Tyrosinase-negative oculocutaneous albinism, not provided, not specified Rs1042602(C;C) None 0 Good Rs1042602(A;A) associated with the absence of freckles
Rs1042713 255 Asthma, nocturnal, susceptibility to, Metabolic syndrome, susceptibility to, salbutamol response - Efficacy, salmeterol response - Efficacy Rs1042713(G;G) normal Rs1042713(A;A) 1.7x increased risk that pediatric inhaler use may make asthma worse 1.7 Bad
Rs1042714 255 Asthma, childhood, susceptibility to, Metabolic syndrome, susceptibility to, Obesity Rs1042714(G;G) complex; see details for increased risks Rs1042714(C;C) normal
Rs1044396 255 not specified Rs1044396(C;C) Increased risk of Nicotine dependence among males 2 Bad Rs1044396(G,T;G,T)
Rs1044397 255 not specified Rs1044397(G;G) Rs1044397(A;A)
... further results


Name Significance Disease Normal S M R Risk S M R
Rs10127939 5 Immunodeficiency 20 Rs10127939(T;T) common in clinvar 0 Good Rs10127939(A,G;A,G)
Rs10151259 5 Cone-rod dystrophy 13, not provided, not specified Rs10151259(G;G) common in clinvar 0 Good Rs10151259(T;T) Recessive genotype uncertain pathogenicity 2 Bad
Rs10250779 5 Glycogen storage disease type X Rs10250779(G;G) common in clinvar 0 Good Rs10250779(A,C;A,C)
Rs10262966 5 Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis Rs10262966(A;A) common in clinvar 0 Good Rs10262966(G;G)
Rs1048095 5 Permanent neonatal diabetes mellitus Rs1048095(T;T) common in clinvar 0 Good Rs1048095(C;C)
Rs104886003 5 Breast adenocarcinoma, Ovarian epithelial cancer, Carcinoma of colon, Neoplasm of stomach, Keratosis, seborrheic, Non-small cell lung cancer, Megalencephaly cutis marmorata telangiectatica congenita, Sarcoma Rs104886003(G;G) common in complete genomics 0 Good Rs104886003(A;A)
Rs104886032 5 Smith-Lemli-Opitz syndrome Rs104886032(A;A) common in clinvar 0 Good Rs104886032(G;G)
Rs104886034 5 Smith-Lemli-Opitz syndrome Rs104886034(C;C) common in clinvar 0 Good Rs104886034(A;A)
Rs104886035 5 not provided, Smith-Lemli-Opitz syndrome Rs104886035(C;C) common in clinvar 0 Good Rs104886035(T;T)
... further results


Name Significance Disease Normal S M R Risk S M R
Rs104886318 4 Alport syndrome, X-linked recessive Rs104886318(;) common in clinvar 0 Good Rs104886318(G;G)
Rs104886326 4 Alport syndrome, X-linked recessive Rs104886326(;) common in clinvar 0 Good Rs104886326(GGGG;GGGG)
Rs104886328 4 Alport syndrome, X-linked recessive Rs104886328(;) common in clinvar 0 Good Rs104886328(C;C)
Rs104886330 4 Alport syndrome, X-linked recessive Rs104886330(AACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA;AACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA) common in clinvar 0 Good Rs104886330(;)
Rs104886353 4 Alport syndrome, X-linked recessive Rs104886353(GGACCAAATGGACAACCT;GGACCAAATGGACAACCT) common in clinvar 0 Good Rs104886353(;)
Rs104886354 4 Alport syndrome, X-linked recessive Rs104886354(AGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGA;AGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGA) common in clinvar 0 Good Rs104886354(;)
Rs104886357 4 Alport syndrome, X-linked recessive Rs104886357(T;T) common in clinvar 0 Good Rs104886357(G;G)
Rs104886364 4 Alport syndrome, X-linked recessive Rs104886364(GTGGTGTACCTGG;GTGGTGTACCTGG) common in clinvar 0 Good Rs104886364(AT;AT)
Rs104886373 4 Alport syndrome, X-linked recessive Rs104886373(AG;AG) common in clinvar 0 Good Rs104886373(;)
... further results


Name Significance Disease Normal S M R Risk S M R
Rs1049650 7 Rs1049650(G;G) common in clinvar 0 Good Rs1049650(C;C)
Rs1049663 7 Rs1049663(G;G) common in clinvar 0 Good Rs1049663(T;T)
Rs1049668 7 Rs1049668(G;G) common in clinvar 0 Good Rs1049668(A;A)
Rs1049709 7 Rs1049709(A;A) common in clinvar 0 Good Rs1049709(G;G)
Rs1049724 7 Rs1049724(G;G) common in clinvar 0 Good Rs1049724(A;A)
Rs1049853 7 Rs1049853(C;C) common in clinvar 0 Good Rs1049853(T;T)
Rs1050105 7 Rs1050105(C;C) common in clinvar 0 Good Rs1050105(T;T)
Rs1050106 7 Rs1050106(C;C) common in clinvar 0 Good Rs1050106(T;T)
Rs1050118 7 Rs1050118(G;G) common in clinvar 0 Good Rs1050118(A;A)
... further results


Name Significance Disease Normal S M R Risk S M R
Rs1003723 2 Familial hypercholesterolemia Rs1003723(C;C) common in clinvar 0 Good Rs1003723(T;T)
Rs10087163 2 not specified Rs10087163(A;A) common in clinvar 0 Good Rs10087163(G;G) common on affy axiom data 0 Good
Rs10227893 2 not specified Rs10227893(T;T) common in complete genomics 0 Good Rs10227893(A,G;A,G)
Rs10380 2 not specified, Gastrointestinal stromal tumor Rs10380(C;C) common in complete genomics 0 Good Rs10380(T;T)
Rs1042391 2 GMP REDUCTASE POLYMORPHISM Rs1042391(T;T) common in clinvar 0 Good Rs1042391(A;A)
Rs1042393 2 not specified Rs1042393(A;A) common in clinvar 0 Good Rs1042393(G;G)
Rs1042636 2 not specified Rs1042636(A;A) common in complete genomics 0 Good Rs1042636(G;G)
Rs1042821 2 Lynch syndrome, not provided, not specified, Hereditary cancer-predisposing syndrome, Lynch syndrome I Rs1042821(C;C) common in clinvar 0 Good Rs1042821(G,T;G,T)
Rs1042917 2 not specified Rs1042917(G;G) common in clinvar 0 Good Rs1042917(A;A)
... further results



Name Significance Disease Normal S M R Risk S M R
Rs104886492 1 not provided Rs104886492(T;T) common in clinvar 0 Good Rs104886492(C;C)
Rs104893623 1 Irido-corneo-trabecular dysgenesis Rs104893623(G;G) common in clinvar 0 Good Rs104893623(A;A)
Rs104893752 1 Dominant hereditary optic atrophy Rs104893752(C;C) common in clinvar 0 Good Rs104893752(T;T)
Rs104894599 1 Mucopolysaccharidosis, MPS-III-B Rs104894599(C;C) common in clinvar 0 Good Rs104894599(A;A)
Rs104894600 1 Mucopolysaccharidosis, MPS-III-B Rs104894600(T;T) common in clinvar 0 Good Rs104894600(C;C)
Rs104894776 1 Immunodeficiency with hyper IgM type 1 Rs104894776(G;G) common in clinvar 0 Good Rs104894776(A;A)
Rs104894807 1 Rs104894807(T;T) common in clinvar 0 Good Rs104894807(C;C)
Rs104894893 1 Congenital adrenal hypoplasia, X-linked Rs104894893(G;G) common in clinvar 0 Good Rs104894893(A;A)
Rs104895089 1 Familial Mediterranean fever Rs104895089(A;A) common in clinvar 0 Good Rs104895089(C;C)
... further results



Name Significance Disease Normal S M R Risk S M R
Rs10306114 6 aspirin response - Efficacy Rs10306114(A;A) normal 0 Good Rs10306114(G;G) Higher risk of bleeding during coronary angiography 3 Bad
Rs1042031 3 not specified Rs1042031(G;G) common in clinvar 0 Good Rs1042031(A,T;A,T)
Rs1042034 3 not specified Rs1042034(G;G) common in clinvar 0 Good Rs1042034(A;A)
Rs1042395 3 not specified, Glycogen storage disease, type II Rs1042395(G;G) common in clinvar 0 Good Rs1042395(A;A)
Rs1042522 6 not specified, not provided, Hereditary cancer-predisposing syndrome, Li-Fraumeni syndrome 1, CODON 72 POLYMORPHISM, (rs1042522), paclitaxel response - Efficacy, Toxicity/ADR, cyclophosphamide response - Efficacy, Toxicity/ADR, antineoplastic agents response - Efficacy, Toxicity/ADR, fluorouracil response - Efficacy, Toxicity/ADR, cisplatin response - Efficacy, Toxicity/ADR, Li-Fraumeni syndrome Rs1042522(C;C) Live 3 years longer. Chemotherapy is more effective. 3 Good Rs1042522(A,G;A,G)
Rs1044394 3 not specified Rs1044394(T;T) common in clinvar 0 Good Rs1044394(C;C) common in complete genomics 0 Good
Rs10455872 6 hmg coa reductase inhibitors response - Efficacy Rs10455872(A;A) common/normal 0 Good Rs10455872(G;G) 2,57x increased Coronary Heart disease risk 3 Bad
Rs1045642 6 ondansetron response - Efficacy, oxycodone response - Dosage, methadone response - Dosage, methotrexate response - Toxicity/ADR, nevirapine response - Toxicity/ADR, tramadol response - Dosage, morphine response - Dosage, digoxin response - Other, opioids response - Dosage, fentanyl response - Dosage Rs1045642(T;T) altered drug metabolism and bioavailability; moderately increased risk for certain cancers 3 Bad Rs1045642(C;C) increased risk of cannabis dependence, lower (normal) cancer risk 1
Rs1047768 3 not specified Rs1047768(T;T) common in clinvar 0 Good Rs1047768(C;C)
Rs104893904 3 Tetralogy of Fallot, Congenital heart disease, not specified Rs104893904(G;G) common in clinvar 0 Good Rs104893904(C;C)
Rs104894184 3 Tumor susceptibility linked to germline BAP1 mutations Rs104894184(T;T) common in complete genomics 0 Good Rs104894184(A,C,G;A,C,G)
Rs104894840 6 not provided, Fabry disease, Deoxygalactonojirimycin response Rs104894840(G;G) common in clinvar 0 Good Rs104894840(A;A)
Rs10497203 6 radiotherapy response - Toxicity/ADR Rs10497203(A;A) common in clinvar 0 Good Rs10497203(C;C)
Rs1052030 3 not specified, not provided Rs1052030(T;T) common in clinvar 0 Good Rs1052030(C;C)
Rs1055311 3 not specified Rs1055311(C;C) common in clinvar 0 Good Rs1055311(T;T)
Rs1056836 6 docetaxel response - Efficacy, not specified, paclitaxel response - Efficacy Rs1056836(G;G) 0.3x decreased risk for prostate cancer 2 Good Rs1056836(C;C) normal
Rs1056892 6 anthracyclines and related substances response - Toxicity/ADR Rs1056892(G;G) common in clinvar 0 Good Rs1056892(A;A)
Rs1057910 6 Warfarin response, Phenytoin response, Glipizide poor metabolizer, Tolbutamide response, diclofenac response - Toxicity/ADR, celecoxib response - Dosage, Antiinflammatory agents, non-steroids response - Toxicity/ADR, celecoxib response - Toxicity/ADR, warfarin response - Dosage, Toxicity/ADR, acenocoumarol response - Dosage, Toxicity/ADR Rs1057910(A;A) normal; no effect on warfarin metabolism 0.1 Good Rs1057910(C;C) CYP2C9*3 homozygote; average 80% reduction in warfarin metabolism; reduced metabolism of number of other drugs 4 Bad
Rs1062087 3 not specified Rs1062087(G;G) common in clinvar 0 Good Rs1062087(A;A)
Rs1065852 6 Debrisoquine, poor metabolism of Rs1065852(C;C) normal 0 Good Rs1065852(T;T) Homozygous for CYP2D6 decreased or non-functioning variants. 3.2 Bad
Rs1084004 3 not specified Rs1084004(T;T) common in clinvar 0 Good Rs1084004(C;C)
Rs10941112 3 not specified Rs10941112(G;G) common in clinvar 0 Good Rs10941112(A;A)
Rs111033610 6 Tegafur response Rs111033610(T;T) common in clinvar 0 Good Rs111033610(C;C)
Rs11212617 6 metformin response - Efficacy Rs11212617(C;C) common in clinvar 0 Good Rs11212617(A;A) normal response to Metformin 0 Good
Rs1126442 3 not specified Rs1126442(G;G) common in clinvar 0 Good Rs1126442(A;A)
Rs113068438 3 Thoracic aortic aneurysm and aortic dissection Rs113068438(A;A) common in clinvar 0 Good Rs113068438(G;G)
Rs1133779 3 not specified Rs1133779(T;T) common in clinvar 0 Good Rs1133779(C;C)
Rs1135840 6 Debrisoquine, ultrarapid metabolism of Rs1135840(C;C) Homozygous for CYP2D6 variants (non-CYP2D6*1) 2 Rs1135840(G;G) normal 0 Good
Rs1142345 6 Thiopurine methyltransferase deficiency Rs1142345(A;A) common in clinvar 0 Good Rs1142345(C;C)
Rs1142530 3 not specified Rs1142530(C;C) common in clinvar 0 Good Rs1142530(T;T)
Rs1143016 3 not specified Rs1143016(C;C) common in clinvar 0 Good Rs1143016(T;T)
Rs11466445 3 not specified, Loeys-Dietz syndrome, Thoracic aortic aneurysm and aortic dissection Rs11466445(GGCGGCGGC;GGCGGCGGC) common in clinvar 0 Good Rs11466445(;)
Rs11547464 3 Cutaneous malignant melanoma 5 Rs11547464(G;G) normal 0 Good Rs11547464(A;A) red hair 3.5
Rs11598702 6 gemcitabine response - Other Rs11598702(T;T) common in clinvar 0 Good Rs11598702(C;C)
Rs11599164 3 not specified Rs11599164(G;G) common in clinvar 0 Good Rs11599164(T;T)
Rs11615 6 platinum response - Efficacy, Toxicity/ADR, carboplatin response - Efficacy, Toxicity/ADR, Platinum compounds response - Efficacy, Toxicity/ADR, cisplatin response - Efficacy, Toxicity/ADR, oxaliplatin response - Efficacy, Toxicity/ADR Rs11615(T;T) common in clinvar 0 Good Rs11615(C;C)
Rs116855232 6 Thiopurines, poor metabolism of, 2, mercaptopurine response - Dosage, Toxicity/ADR, azathioprine response - Dosage, Toxicity/ADR Rs116855232(C;C) common in clinvar 0 Good Rs116855232(T;T)
Rs118109635 3 not provided Rs118109635(G;G) common in clinvar 0 Good Rs118109635(A;A)
Rs119457968 6 Ezetimibe response Rs119457968(G;G) common in clinvar 0 Good Rs119457968(A,C,T;A,C,T)
Rs1208 6 Slow acetylator due to N-acetyltransferase enzyme variant Rs1208(G;G) common in clinvar 0 Good Rs1208(A;A) 0
Rs121434568 6 Nonsmall cell lung cancer, response to tyrosine kinase inhibitor in, somatic, Adenocarcinoma of lung, response to tyrosine kinase inhibitor in, somatic, Tyrosine kinase inhibitor response, carboplatin, docetaxel, erlotinib, gemcitabine, and paclitaxel response - Efficacy, gefitinib response - Efficacy, erlotinib response - Efficacy Rs121434568(T;T) common in clinvar 0 Good Rs121434568(G;G)
Rs12150338 3 not specified Rs12150338(C;C) common on affy axiom data 0 Good Rs12150338(T;T)
Rs1217401 3 not specified Rs1217401(A;A) common in clinvar 0 Good Rs1217401(G;G)
Rs121908338 3 Dilated cardiomyopathy 1C, not specified, Dilated cardiomyopathy, not provided, Myofibrillar myopathy, ZASP-related Rs121908338(G;G) common in clinvar 0 Good Rs121908338(A,C;A,C)
Rs121908755 6 Cystic fibrosis, ivacaftor response - Efficacy Rs121908755(G;G) common in clinvar 0 Good Rs121908755(A,T;A,T)
Rs121908757 6 Cystic fibrosis, ivacaftor response - Efficacy Rs121908757(A;A) common in clinvar 0 Good Rs121908757(C;C)
Rs121909005 6 Cystic fibrosis, ivacaftor response - Efficacy Rs121909005(T;T) common in clinvar 0 Good Rs121909005(G;G)
Rs121909013 6 Cystic fibrosis, ivacaftor response - Efficacy, not provided Rs121909013(G;G) common in clinvar 0 Good Rs121909013(A;A)
Rs121909041 6 Cystic fibrosis, Ivacaftor response Rs121909041(T;T) common in clinvar 0 Good Rs121909041(C;C)
... further results


 ClinVar CLNSIGClinVar CLNDBNRefGenoRiskGenoGMAFOn microarray
rs2893547552-methyl-3-hydroxybutyric aciduriars28935475(C;C)Rs28935475(T;T)23andMe v1
Illumina Human 1M
23andMe v2
23andMe v3
23andMe v4
rs2893547652-methyl-3-hydroxybutyric aciduriars28935476(C;C)Rs28935476(G;G)23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs6262630552-methyl-3-hydroxybutyric aciduriars62626305(G;G)Rs62626305(C;C)23andMe v3
23andMe v4
Ancestry v2
rs12530380521-hydroxylase deficiencyrs12530380(T;T)Rs12530380(A;A)23andMe v3
23andMe v4
rs6445521-hydroxylase deficiencyrs6445(C;C)rs6445(T;T)23andMe v4
rs2893488053 beta-Hydroxysteroid dehydrogenase deficiencyrs28934880(C;C)rs28934880(A;A)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs2893789953-Methylglutaconic aciduria type 3rs28937899(C;C)Rs28937899(T;T)23andMe v3
23andMe v4
rs115451054-Alpha-hydroxyphenylpyruvate hydroxylase deficiencyrs1154510(A;A)rs1154510(G;G)0.13223andMe v1
23andMe v2
23andMe v3
23andMe v4
FTDNA2
FamilyTreeDNA
HumanOmni1Quad
Illumina Human 1M
Ancestry v2
rs127215105ACTH deficiencyrs12721510(C;C)rs12721510(A;A)0.020223andMe v3
FTDNA2
HumanOmni1Quad
Illumina Human 1M
23andMe v4
Ancestry v2
rs289408925ACTH resistancers28940892(A;A)Rs28940892(G;G)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs5536685ALPHA-2A ADRENERGIC RECEPTOR, OVEREXPRESSION or TYPE 2 DIABETES SUSCEPTIBILITY (safer to say the former than the latter)rs553668(T;T)rs553668(C;C)0.2923andMe v1
23andMe v2
23andMe v3
FTDNA2
HumanOmni1Quad
Illumina Human 1M
23andMe v4
Ancestry v2
rs18004355AMINOLEVULINATE DEHYDRATASE, ALAD*1/ALAD*2 POLYMORPHISMrs1800435(G;G)Rs1800435(C;C)0.046823andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs174735ANTICHYMOTRYPSIN BONN 1rs17473(C;C)Rs17473(G,T;G,T)0.0018423andMe v1
23andMe v3
Affy GenomeWide 6
HumanOmni1Quad
23andMe v4
Ancestry v2
rs289315785APOE2 VARIANTrs28931578(G;G)Rs28931578(A,C;A,C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs289315775APOE3 VARIANTrs28931577(G;G)Rs28931577(A;A)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315765APOE3(-)-FREIBURGrs28931576(A;A)Rs28931576(G;G)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315795APOE4(+)rs28931579(A;A)Rs28931579(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs7694525APOE4(-)-FREIBURGrs769452(T;T)Rs769452(C;C)0.0013823andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289294765APOLIPOPROTEIN A-I (BALTIMORE)rs28929476(G;G)Rs28929476(T;T)23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315735APOLIPOPROTEIN A-I (MILANO)rs28931573(C;C)rs28931573(T;T)23andMe v2
23andMe v3
23andMe v4
rs51105APOLIPOPROTEIN A-IV POLYMORPHISM, APOA4*1/APOA4*2rs5110(G;G)Rs5110(T;T)0.033123andMe v2
23andMe v3
FTDNA2
HumanOmni1Quad
Illumina Human 1M
23andMe v4
Ancestry v2
rs51225APOLIPOPROTEIN C-II (SAN FRANCISCO)rs5122(G;G)Rs5122(A;A)0.00184Illumina Human 1M
Ancestry v2
rs289991135APRT deficiency, Japanese type
Adenine phosphoribosyltransferase deficiency
rs28999113(T;T)Rs28999113(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs20714215ARYLSULFATASE A POLYMORPHISM
Metachromatic leukodystrophy
not provided
rs2071421(A;A)Rs2071421(G;G)0.20923andMe v1
Illumina Human 1M
23andMe v2
23andMe v3
HumanOmni1Quad
23andMe v4
Ancestry v2
rs289354975Aarskog syndromers28935497(G;G)Rs28935497(A;A)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289402825Acampomelic campomelic dysplasiars28940282(C;C)Rs28940282(T;T)23andMe v2
23andMe v3
23andMe v4
rs289316145Achondroplasia
Epidermal nevus
rs28931614(G;G)Rs28931614(A,C;A,C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs455897415Acquired long QT syndromers45589741(T;T)Rs45589741(C;C)23andMe v3
23andMe v4
Ancestry v2
rs289378895Acroerythrokeratodermars28937889(A;A)Rs28937889(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315815Acromesomelic dysplasia Maroteaux typers28931581(C;C)Rs28931581(A;A)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289315825Acromesomelic dysplasia Maroteaux typers28931582(T;T)Rs28931582(G;G)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs289294795Acromesomelic dysplasia Maroteaux typers28929479(T;T)Rs28929479(A;A)23andMe v1
23andMe v3
23andMe v4
Ancestry v2
rs289315905Acute myeloid leukemiars28931590(A;A)rs28931590(T;T)23andMe v1
23andMe v2
23andMe v3
23andMe v4
rs735983745Adenosine deaminase 2 allozymers73598374(G;G)Rs73598374(A;A)0.044123andMe v3
23andMe v4
Ancestry v2
rs725475085Adrenal insufficiency, congenital, with 46,XY sex reversal, partial or completers72547508(C;C)Rs72547508(T;T)23andMe v3
23andMe v4
Ancestry v2
rs10640395Age-related macular degeneration 11rs1064039(G;G)rs1064039(A;A)0.18923andMe v2
23andMe v3
23andMe v4
rs93327395Age-related macular degeneration 14rs9332739(G;G)rs9332739(C;C)0.030323andMe v1
23andMe v2
23andMe v3
FTDNA2
FamilyTreeDNA
HumanOmni1Quad
Illumina Human 1M
23andMe v4
Ancestry v2
rs41516675Age-related macular degeneration 14rs4151667(T;T)rs4151667(A;A)0.029823andMe v1
23andMe v2
23andMe v3
FTDNA2
HumanOmni1Quad
Illumina Human 1M
23andMe v4
Ancestry v2
rs289390725Age-related macular degeneration 3rs28939072(T;T)Rs28939072(C;C)23andMe v4
Ancestry v2
rs587322445Alexander's disease
not provided
rs58732244(A;A)Rs58732244(T;T)23andMe v3
23andMe v4
Ancestry v2
rs580641225Alexander's disease
not provided
rs58064122(C;C)Rs58064122(T;T)23andMe v3
23andMe v4
Ancestry v2
rs289327695Alexander's disease
not provided
rs28932769(T;T)Rs28932769(C;C)23andMe v1
23andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs597932935Alexander's disease
not provided
rs59793293(C;C)Rs59793293(A,G,T;A,G,T)23andMe v3
23andMe v4
rs616229355Alexander's disease
not provided
rs61622935(C;C)Rs61622935(A,T;A,T)23andMe v3
23andMe v4
rs571207615Alexander's disease
not provided
rs57120761(C;C)Rs57120761(G,T;G,T)23andMe v3
23andMe v4
rs289421005Alkaptonuriars28942100(C;C)Rs28942100(T;T)4.591e-423andMe v2
23andMe v3
23andMe v4
Ancestry v2
rs70148515Alopecia universalis congenitars7014851(T;T)rs7014851(C;C)0.075323andMe v1
Illumina Human 1M
23andMe v2
23andMe v3
FTDNA2
HumanOmni1Quad
23andMe v4
Ancestry v2
rs414577465Alpha plus thalassemiars41457746(A;A)Rs41457746(G;G)23andMe v3
23andMe v4
rs637514575Alpha plus thalassemiars63751457(C;C)Rs63751457(T;T)23andMe v3
23andMe v4
rs617618695Alpha-1-antitrypsin deficiencyrs61761869(G;G)Rs61761869(A;A)23andMe v3
23andMe v4
Ancestry v2
... further results