Have questions? Visit https://www.reddit.com/r/SNPedia

Genotype

From SNPedia

As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one inherited from Dad, one inherited from Mom. Example: rs1234(A;C) is how we indicate someone with a (A;C) genotype at snp rs1234.

However, this definition of 'genotype' varies a bit from the one intended when it first introduced over 100 years ago [10.1126/science.35.896.340], and even from the most common usage in genetics textbooks. Although genotype can refer to an individual's genetic constitution (as a whole), the most typical usage is to refer to the pair of alleles carried by an individual at a given locus (or gene). Alleles are classically defined by their protein products and mode of inheritance (e.g. dominant, recessive, etc.), but at a molecular level, alleles may also be defined by one or more co-inherited SNPs.

See also Magnitude and Repute

Notable genotypes

 MagnitudeReputeSummary
I4000378(I;I)10BadBRCA1 (breast cancer) 5382insC
Rs779709646(T;T)9BadSmith-Lemli-Opitz syndrome
Rs770374710(-;G)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
Rs398122418(C;T)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
Rs398122417(-;AT)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
Rs398122416(-;C)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
Rs398122415(-;T)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
Rs201662623(C;C)9BadOrofaciodigital syndrome likely
Rs200322968(T;T)9BadOrofaciodigital syndrome likely
Rs150681845(A;A)9BadOrofaciodigital syndrome likely
Rs373900644(T;T)9BadOrofaciodigital syndrome likely
Rs200649783(A;A)9BadOrofaciodigital syndrome likely
Rs137891647(G;G)9BadLipoyltransferase 1 deficiency (severe)
Rs786205156(G;G)9BadLipoyltransferase 1 deficiency (severe)
Rs767568897(T;T)9BadLipoyltransferase 1 deficiency (severe)
Rs137973334(T;T)9BadLipoyltransferase 1 deficiency
Rs80338859(T;T)9BadMiscall for 23andMe customers; otherwise, Smith-Lemli-Opitz syndrome
Rs869025342(G;G)9BadInfantile hypotonia with psychomotor retardation
Rs28942089(C;T)9BadDenys-Drash syndrome
Rs28941779(C;T)9BadFrasier syndrome mutation
Rs28941778(A;G)9BadDenys-Drash syndrome
Rs267606795(C;C)9BadRaine syndrome
Rs63751037(A;G)9Badearly-onset Alzheimers disease
Rs63751068(G;T)9BadPicks disease of the brain
Rs661(A;A)9Badearly onset Alzheimer's disease
Rs661(A;G)9Badearly-onset Alzheimers disease
Rs63751320(A;C)9Badearly-onset Alzheimers disease
Rs63751235(C;G)9Badearly-onset Alzheimers disease
Rs63751229(C;T)9Badearly-onset Alzheimers disease
Rs63751223(C;G)9Badearly-onset Alzheimers disease
Rs63751163(C;T)9Badearly-onset Alzheimers disease
Rs63751144(A;C)9Badearly-onset Alzheimers disease
Rs63751141(C;G)9Badearly-onset Alzheimers disease
Rs63750900(A;G)9Badearly-onset Alzheimers disease
Rs63750886(C;G)9Badearly-onset Alzheimers disease
Rs63750815(G;T)9Badearly-onset Alzheimers disease
Rs63750599(C;T)9Badearly-onset Alzheimers disease
Rs63750577(C;T)9Badearly-onset Alzheimers disease
Rs63749891(C;G)9Badearly-onset Alzheimers disease
Rs63749885(C;T)9Badearly-onset Alzheimers disease
Rs28936380(C;G)9Badearly-onset Alzheimer's disease
Rs28936379(A;G)9Badearly-onset Alzheimers disease
Rs63750215(A;T)9Badearly-onset Alzheimer's disease
Rs63750048(C;T)9Badearly-onset Alzheimers disease (atypical)
Rs63749851(A;C)9BadEarly-onset Alzheimer's disease
I4000378(D;I)9BadBRCA1 (breast cancer) 5382insC heterozygous carrier
rs121917967(A;T)8BadDravet syndrome and severe epileptic seizure syndrome(s) possible
rs267606684(T;T)8BadBrown-Vialetto-Van Laere Syndrome
rs267606685(C;C)8BadBrown-Vialetto-Van Laere Syndrome
rs267606688(A;A)8BadBrown-Vialetto-Van Laere Syndrome
rs267606683(T;T)8BadBrown-Vialetto-Van Laere Syndrome
Rs749788626(T;T)8BadArgininosuccinate lyase deficiency
Rs373697663(A;A)8BadArgininosuccinate lyase deficiency
Rs769960006(T;T)8BadArgininosuccinate lyase deficiency
Rs143793815(T;T)8BadArgininosuccinate lyase deficiency
Rs767543051(T;T)8BadArgininosuccinate lyase deficiency
Rs138310841(T;T)8BadArgininosuccinate lyase deficiency
Rs202142867(C;C)8BadArgininosuccinate lyase deficiency
Rs752100894(G;G)8BadArgininosuccinate lyase deficiency
Rs796051928(C;C)8BadArgininosuccinate lyase deficiency
Rs770167670(A;A)8BadArgininosuccinate lyase deficiency
Rs769506424(A;A)8BadArgininosuccinate lyase deficiency
Rs369879957(T;T)8BadArgininosuccinate lyase deficiency
Rs398123127(A;A)8BadArgininosuccinate lyase deficiency
Rs751590073(A;A)8BadArgininosuccinate lyase deficiency
Rs398123126(T;T)8BadArgininosuccinate lyase deficiency
Rs796051932(TGGCACTGACCCGAGACTCTGAGCG;TGGCACTGACCCGAGACTCTGAGCG)8BadArgininosuccinate lyase deficiency
Rs142637046(A;A)8BadArgininosuccinate lyase deficiency
Rs796051931(A;A)8BadArgininosuccinate lyase deficiency
Rs201523601(T;T)8BadArgininosuccinate lyase deficiency
Rs145138923(A;A)8BadArgininosuccinate lyase deficiency
Rs28941473(A;A)8BadArgininosuccinate lyase deficiency
Rs199938613(T;T)8BadArgininosuccinate lyase deficiency
Rs374304304(T;T)8BadArgininosuccinate lyase deficiency
Rs367543006(T;T)8BadArgininosuccinate lyase deficiency
Rs367543005(T;T)8BadArgininosuccinate lyase deficiency
Rs28941472(G;G)8BadArgininosuccinate lyase deficiency
Rs28940585(T;T)8BadArgininosuccinate lyase deficiency
Rs28940287(T;T)8BadArgininosuccinate lyase deficiency
Rs28940286(T;T)8BadArgininosuccinate lyase deficiency
Rs796856605(-;CT)8BadBRCA1 (breast cancer) 185delAG carrier
Rs796065306(A;G)8BadDyskinesia, familial, with facial myokymia
I5009999(D;I)8BadBRCA1 (breast cancer) 185delAG carrier
I4000377(D;I)8BadBRCA1 (breast cancer) 185delAG carrier
I4000377(D;D)8BadBRCA1 (breast cancer) 185delAG homozygous carrier
Rs63750231(A;C)8BadEarly-onset Alzheimer's disease (in some cases)
Rs386833395(-;AG)8BadBRCA1 (breast cancer) 185delAG carrier
Rs1064651(G;G)8Badpossibly Gaucher's disease, but more likely a mis-oriented interpretation
Rs587777149(A;A)8Badinherited C59 deficiency
Rs587777149(-;-)8Badinherited CD59 deficiency
I4000292(D;D)8Badcystic fibrosis
Rs63750590(A;G)8Badearly onset Alzheimers disease
Rs63750526(A;C)8Badearly-onset Alzheimers disease
Rs63750218(C;T)8BadAlzheimers disease
Rs63750666(C;T)8Badearly-onset Alzheimer's disease; penetrance unclear
Rs63749884(A;G)8Badearly-onset Alzheimer's disease; penetrance not 100%
Rs587776982(-;-)8BadHomozygous for defective NGLY1 allele, leading to congenital disorder of deglycosylation (CDDG)
Rs587777266(-;-)8BadHomozygous for defective NGLY1 allele, leading to congenital disorder of deglycosylation (CDDG)
Rs587777265(C;C)8BadHomozygous for defective NGLY1 allele, leading to congenital disorder of deglycosylation (CDDG)
Rs528583612(A;A)8BadHomozygous for defective NGLY1 allele, leading to congenital disorder of deglycosylation (CDDG)
... further results