Have questions? Visit https://www.reddit.com/r/SNPedia

Genotype

From SNPedia

As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one inherited from Dad, one inherited from Mom. Example: rs1234(A;C) is how we indicate someone with a (A;C) genotype at snp rs1234.

However, this definition of 'genotype' varies a bit from the one intended when it first introduced over 100 years ago [10.1126/science.35.896.340], and even from the most common usage in genetics textbooks. Although genotype can refer to an individual's genetic constitution (as a whole), the most typical usage is to refer to the pair of alleles carried by an individual at a given locus (or gene). Alleles are classically defined by their protein products and mode of inheritance (e.g. dominant, recessive, etc.), but at a molecular level, alleles may also be defined by one or more co-inherited SNPs.

See also Magnitude and Repute

Notable genotypes

 MagnitudeReputeSummary
i4000378(I;I)10BadBRCA1 (breast cancer) 5382insC
rs587777465(C;C)9BadPontocerebellar hypoplasia type 2E
rs587777466(T;T)9BadPontocerebellar hypoplasia type 2E
rs773876739(C;C)9BadPontocerebellar hypoplasia type 2D
rs267607036(G;G)9BadPontocerebellar hypoplasia type 2D
rs267607035(A;A)9BadPontocerebellar hypoplasia type 2D
rs779709646(T;T)9BadSmith-Lemli-Opitz syndrome
rs770374710(-;G)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
rs398122418(C;T)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
rs398122417(-;AT)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
rs398122416(-;C)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
rs398122415(-;T)9BadPrader-Willi-like syndrome; Schaaf-Yang syndrome
rs201662623(C;C)9BadOrofaciodigital syndrome likely
rs200322968(T;T)9BadOrofaciodigital syndrome likely
rs150681845(A;A)9BadOrofaciodigital syndrome likely
rs373900644(T;T)9BadOrofaciodigital syndrome likely
rs200649783(A;A)9BadOrofaciodigital syndrome likely
rs137891647(G;G)9BadLipoyltransferase 1 deficiency (severe)
rs786205156(G;G)9BadLipoyltransferase 1 deficiency (severe)
rs767568897(T;T)9BadLipoyltransferase 1 deficiency (severe)
rs137973334(T;T)9BadLipoyltransferase 1 deficiency
rs80338859(T;T)9BadMiscall for 23andMe customers; otherwise, Smith-Lemli-Opitz syndrome
rs869025342(G;G)9BadInfantile hypotonia with psychomotor retardation
rs28942089(C;T)9BadDenys-Drash syndrome
rs28941779(C;T)9BadFrasier syndrome mutation
rs28941778(A;G)9BadDenys-Drash syndrome
rs267606795(C;C)9BadRaine syndrome
rs63751037(A;G)9Badearly-onset Alzheimers disease
rs63751068(G;T)9BadPicks disease of the brain
rs661(A;A)9Badearly onset Alzheimer's disease
rs661(A;G)9Badearly-onset Alzheimers disease
rs63751320(A;C)9Badearly-onset Alzheimers disease
rs63751235(C;G)9Badearly-onset Alzheimers disease
rs63751229(C;T)9Badearly-onset Alzheimers disease
rs63751223(C;G)9Badearly-onset Alzheimers disease
rs63751163(C;T)9Badearly-onset Alzheimers disease
rs63751144(A;C)9Badearly-onset Alzheimers disease
rs63751141(C;G)9Badearly-onset Alzheimers disease
rs63750900(A;G)9Badearly-onset Alzheimers disease
rs63750886(C;G)9Badearly-onset Alzheimers disease
rs63750815(G;T)9Badearly-onset Alzheimers disease
rs63750599(C;T)9Badearly-onset Alzheimers disease
rs63750577(C;T)9Badearly-onset Alzheimers disease
rs63749891(C;G)9Badearly-onset Alzheimers disease
rs63749885(C;T)9Badearly-onset Alzheimers disease
rs28936380(C;G)9Badearly-onset Alzheimer's disease
rs28936379(A;G)9Badearly-onset Alzheimers disease
rs63750215(A;T)9Badearly-onset Alzheimer's disease
rs63750048(C;T)9Badearly-onset Alzheimers disease (atypical)
rs63749851(A;C)9BadEarly-onset Alzheimer's disease
i4000378(D;I)9BadBRCA1 (breast cancer) 5382insC heterozygous carrier
rs121917967(A;T)8BadDravet syndrome and severe epileptic seizure syndrome(s) possible
rs267606684(T;T)8BadBrown-Vialetto-Van Laere Syndrome
rs267606685(C;C)8BadBrown-Vialetto-Van Laere Syndrome
rs267606688(A;A)8BadBrown-Vialetto-Van Laere Syndrome
rs267606683(T;T)8BadBrown-Vialetto-Van Laere Syndrome
rs749788626(T;T)8BadArgininosuccinate lyase deficiency
rs373697663(A;A)8BadArgininosuccinate lyase deficiency
rs769960006(T;T)8BadArgininosuccinate lyase deficiency
rs143793815(T;T)8BadArgininosuccinate lyase deficiency
rs767543051(T;T)8BadArgininosuccinate lyase deficiency
rs138310841(T;T)8BadArgininosuccinate lyase deficiency
rs202142867(C;C)8BadArgininosuccinate lyase deficiency
rs752100894(G;G)8BadArgininosuccinate lyase deficiency
rs796051928(C;C)8BadArgininosuccinate lyase deficiency
rs770167670(A;A)8BadArgininosuccinate lyase deficiency
rs769506424(A;A)8BadArgininosuccinate lyase deficiency
rs369879957(T;T)8BadArgininosuccinate lyase deficiency
rs398123127(A;A)8BadArgininosuccinate lyase deficiency
rs751590073(A;A)8BadArgininosuccinate lyase deficiency
rs398123126(T;T)8BadArgininosuccinate lyase deficiency
rs796051932(TGGCACTGACCCGAGACTCTGAGCG;TGGCACTGACCCGAGACTCTGAGCG)8BadArgininosuccinate lyase deficiency
rs142637046(A;A)8BadArgininosuccinate lyase deficiency
rs796051931(A;A)8BadArgininosuccinate lyase deficiency
rs201523601(T;T)8BadArgininosuccinate lyase deficiency
rs145138923(A;A)8BadArgininosuccinate lyase deficiency
rs28941473(A;A)8BadArgininosuccinate lyase deficiency
rs199938613(T;T)8BadArgininosuccinate lyase deficiency
rs374304304(T;T)8BadArgininosuccinate lyase deficiency
rs367543006(T;T)8BadArgininosuccinate lyase deficiency
rs367543005(T;T)8BadArgininosuccinate lyase deficiency
rs28941472(G;G)8BadArgininosuccinate lyase deficiency
rs28940585(T;T)8BadArgininosuccinate lyase deficiency
rs28940287(T;T)8BadArgininosuccinate lyase deficiency
rs28940286(T;T)8BadArgininosuccinate lyase deficiency
rs796856605(-;CT)8BadBRCA1 (breast cancer) 185delAG carrier
rs796065306(A;G)8BadDyskinesia, familial, with facial myokymia
i5009999(D;I)8BadBRCA1 (breast cancer) 185delAG carrier
i4000377(D;I)8BadBRCA1 (breast cancer) 185delAG carrier
i4000377(D;D)8BadBRCA1 (breast cancer) 185delAG homozygous carrier
rs63750231(A;C)8BadEarly-onset Alzheimer's disease (in some cases)
rs386833395(-;AG)8BadBRCA1 (breast cancer) 185delAG carrier
rs1064651(G;G)8Badpossibly Gaucher's disease, but more likely a mis-oriented interpretation
rs587777149(A;A)8Badinherited C59 deficiency
rs587777149(-;-)8Badinherited CD59 deficiency
i4000292(D;D)8Badcystic fibrosis
rs63750590(A;G)8Badearly onset Alzheimers disease
rs63750526(A;C)8Badearly-onset Alzheimers disease
rs63750218(C;T)8BadAlzheimers disease
rs63750666(C;T)8Badearly-onset Alzheimer's disease; penetrance unclear
... further results