Have questions? Visit https://www.reddit.com/r/SNPedia

rs104886330

From SNPedia

ClinVar
Risk rs104886330(;)
Alt rs104886330(;)
Reference rs104886330(AACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA;AACCTGGTTTGCCAGGTCTCCCAGGTCCTCCAGGTAA)
Significance Probable-Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107838799_107838835del37
CLNSRC
CLNACC


[PMID 8651296OA-icon.png] X-linked Alport syndrome: an SSCP-based mutation survey over all 51 exons of the COL4A5 gene.