Have questions? Visit https://www.reddit.com/r/SNPedia

rs104886342

From SNPedia

ClinVar
Risk rs104886342(GGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT;GGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT)
Alt rs104886342(GGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT;GGCAACCAGGCTTGCCAGGGATACCTGGTAGCAAAGGAGAACCAGGTATCCCT)
Reference rs104886342(;)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107845135_107845187dup53
CLNSRC ClinVar
CLNACC RCV000021363.1,


[PMID 17660027] Genetic testing for X-linked Alport syndrome by direct sequencing of COL4A5 cDNA from hair root RNA samples.