Have questions? Visit https://www.reddit.com/r/SNPedia

rs104886346

From SNPedia

ClinVar
Risk rs104886346(;)
Alt rs104886346(;)
Reference rs104886346(GAAGGCCCTCCTGGGCCACCC;GAAGGCCCTCCTGGGCCACCC)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107846253_107846273del21
CLNSRC ClinVar
CLNACC RCV000021374.1,


[PMID 16941480] A two-tier approach to mutation detection in the COL4A5 gene for Alport syndrome.