Have questions? Visit https://www.reddit.com/r/SNPedia

rs104886354

From SNPedia

ClinVar
Risk rs104886354(;)
Alt rs104886354(;)
Reference rs104886354(AGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGA;AGTCCAGGGATCCCCGGAGCACCTGGTCCTATAGGA)
Significance Probable-Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107863569_107863604del36
CLNSRC
CLNACC


[PMID 10862091] Spectrum of COL4A5 mutations in Finnish Alport syndrome patients.