Have questions? Visit https://www.reddit.com/r/SNPedia

rs104886359

From SNPedia

ClinVar
Risk rs104886359(;)
Alt rs104886359(;)
Reference rs104886359(TCCAGGACCTCCTGGACTTGATGT;TCCAGGACCTCCTGGACTTGATGT)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107863529_107863552del24
CLNSRC ClinVar
CLNACC RCV000021414.1,


[PMID 15780079] Detection of mutations in the COL4A5 gene by analyzing cDNA of skin fibroblasts.