Have questions? Visit https://www.reddit.com/r/SNPedia

rs111033388

From SNPedia

ClinVar
Risk rs111033388(CCATGAGCAAACAGCGGGGCT;CCATGAGCAAACAGCGGGGCT)
Alt rs111033388(CCATGAGCAAACAGCGGGGCT;CCATGAGCAAACAGCGGGGCT)
Reference rs111033388(;)
Significance Probable-Pathogenic
Disease Usher syndrome
Variation info
Gene MYO7A
CLNDBN Usher syndrome, type 1
Reversed 0
HGVS NC_000011.9:g.76925707_76925727dup21
CLNSRC
CLNACC RCV000154448.1,