Have questions? Visit https://www.reddit.com/r/SNPedia

rs113994086

From SNPedia

ClinVar
Risk rs113994086(;)
Alt rs113994086(;)
Reference rs113994086(GTACTGATGGCTTTCTACCAG;GTACTGATGGCTTTCTACCAG)
Significance Pathogenic
Disease Leukoencephalopathy with vanishing white matter
Variation info
Gene EIF2B5
CLNDBN Leukoencephalopathy with vanishing white matter
Reversed 0
HGVS NC_000003.11:g.183862385_183862405del21
CLNSRC
CLNACC


OMIM603896
Desc
Variant
Relatedalso