Have questions? Visit https://www.reddit.com/r/SNPedia

rs113994178

From SNPedia

ClinVar
Risk rs113994178(;)
Alt rs113994178(;)
Reference rs113994178(CGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC;CGACGCCTGCGAAGATGGCCGCTGCGTCCTCATCGGATTC)
Significance Pathogenic
Disease Bardet-Biedl syndrome
Variation info
Gene BBS1
CLNDBN Bardet-Biedl syndrome
Reversed 0
HGVS NC_000011.9:g.66278128_66278167del40
CLNSRC GeneReviews
CLNACC RCV000020906.2,


[PMID 12524598OA-icon.png] Evaluation of complex inheritance involving the most common Bardet-Biedl syndrome locus (BBS1).