Have questions? Visit https://www.reddit.com/r/SNPedia

rs113994204

From SNPedia

ClinVar
Risk rs113994204(;)
Alt rs113994204(;)
Reference rs113994204(TATTACTATCCTTGAGCTCCC;TATTACTATCCTTGAGCTCCC)
Significance Other
Disease Cystinosis
Variation info
Gene CTNS
CLNDBN Cystinosis
Reversed 0
HGVS NC_000017.10:g.3552198_3552218del21
CLNSRC ClinVar GeneReviews
CLNACC RCV000020623.4,