Have questions? Visit https://www.reddit.com/r/SNPedia

rs113994204

From SNPedia

ClinVar
Risk
Alt
Reference Rs113994204(TATTACTATCCTTGAGCTCCC;TATTACTATCCTTGAGCTCCC)
Significance Other
Disease Nephropathic cystinosis
Variation info
Gene CTNS
CLNDBN Nephropathic cystinosis
Reversed 0
HGVS NC_000017.10:g.3552198_3552218del21
CLNSRC ClinVar GeneReviews
CLNACC RCV000020623.4,