Have questions? Visit https://www.reddit.com/r/SNPedia

rs113994211

From SNPedia

ClinVar
Risk rs113994211(;)
Alt rs113994211(;)
Reference rs113994211(TGCCCTACATCAAGGTACGGCCTTGCC;TGCCCTACATCAAGGTACGGCCTTGCC)
Significance Other
Disease Cystinosis
Variation info
Gene CTNS
CLNDBN Cystinosis
Reversed 0
HGVS NC_000017.10:g.3559878_3559904del27
CLNSRC ClinVar GeneReviews
CLNACC RCV000020627.4,


[PMID 12442267] Identification of 14 novel CTNS mutations and characterization of seven splice site mutations associated with cystinosis.