Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;TTCTACAACAAGAGCGAGGAT) 4 likely severe central core disease

Make rs118192169(-;-)
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
1000 genomesrs118192169
23andMe allrs118192169
SNP Nexus

GWAS Ctlgrs118192169
Max Magnitude4
Significance Pathogenic
Disease Central core disease
Variation info
Gene RYR1
CLNDBN Central core disease
Reversed 0
HGVS NC_000019.9:g.39071085_39071105del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000013858.24,

[PMID 12566385] Clinical and functional effects of a deletion in a COOH-terminal lumenal loop of the skeletal muscle ryanodine receptor.