Have questions? Visit https://www.reddit.com/r/SNPedia

rs118192169

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;TTCTACAACAAGAGCGAGGAT) 4 likely severe central core disease
(TTCTACAACAAGAGCGAGGAT;TTCTACAACAAGAGCGAGGAT) 0 common in clinvar


Make rs118192169(-;-)
ReferenceGRCh38 38.1/141
Chromosome19
Position38580445
GeneRYR1
is asnp
is mentioned by
dbSNPrs118192169
ebirs118192169
HLIrs118192169
Exacrs118192169
Varsomers118192169
Maprs118192169
PheGenIrs118192169
hapmaprs118192169
1000 genomesrs118192169
hgdprs118192169
ensemblrs118192169
gopubmedrs118192169
geneviewrs118192169
scholarrs118192169
googlers118192169
pharmgkbrs118192169
gwascentralrs118192169
openSNPrs118192169
23andMers118192169
23andMe allrs118192169
SNP Nexus

SNPshotrs118192169
SNPdbers118192169
MSV3drs118192169
GWAS Ctlgrs118192169
Max Magnitude4
OMIM180901
Desc
Variant0024
Relatedalso
ClinVar
Risk rs118192169(;)
Alt rs118192169(;)
Reference rs118192169(TTCTACAACAAGAGCGAGGAT;TTCTACAACAAGAGCGAGGAT)
Significance Pathogenic
Disease Central core disease
Variation info
Gene RYR1
CLNDBN Central core disease
Reversed 0
HGVS NC_000019.9:g.39071085_39071105del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000013858.23,


[PMID 12566385] Clinical and functional effects of a deletion in a COOH-terminal lumenal loop of the skeletal muscle ryanodine receptor.