Have questions? Visit https://www.reddit.com/r/SNPedia

rs121908777

From SNPedia

OMIM602421
Desc
Variant0044
Relatedalso
ClinVar
Risk rs121908777(A,AGGAGTTCTGAAAATGTCCCATAAAAATAGCTGCTACCTTCATGCAAAATTAATATTTTGTCAGCTTTCTTTAAATGTTCCATTT;A,AGGAGTTCTGAAAATGTCCCATAAAAATAGCTGCTACCTTCATGCAAAATTAATATTTTGTCAGCTTTCTTTAAATGTTCCATTT)
Alt rs121908777(A,AGGAGTTCTGAAAATGTCCCATAAAAATAGCTGCTACCTTCATGCAAAATTAATATTTTGTCAGCTTTCTTTAAATGTTCCATTT;A,AGGAGTTCTGAAAATGTCCCATAAAAATAGCTGCTACCTTCATGCAAAATTAATATTTTGTCAGCTTTCTTTAAATGTTCCATTT)
Reference rs121908777(AAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC;AAATGGAACATTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCC)
Significance Other
Disease Cystic fibrosis
Variation info
Gene CFTR
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117232041_117232124del84
CLNSRC OMIM Allelic Variant
CLNACC RCV000046486.5,