Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

common in clinvar
Is agenotype
Geno Mag Summary
(-;AGGGAGAATGATGATGAAGTAC) 3 carrier of a cystic fibrosis allele