Have questions? Visit https://www.reddit.com/r/SNPedia

rs121913463

From SNPedia

ClinVar
Risk rs121913463(;)
Alt rs121913463(;)
Reference rs121913463(TCTCCGAAAGCCAACAAGGAAATC;TCTCCGAAAGCCAACAAGGAAATC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242484_55242507del24
CLNSRC
CLNACC RCV000154195.1,