Have questions? Visit https://www.reddit.com/r/SNPedia

rs137853929

From SNPedia

ClinVar
Risk rs137853929(;)
Alt rs137853929(;)
Reference rs137853929(CAATCCGCGCGGCGGCCGCCGCC;CAATCCGCGCGGCGGCCGCCGCC)
Significance Pathogenic
Disease Cold-induced sweating syndrome 1
Variation info
Gene CRLF1
CLNDBN Cold-induced sweating syndrome 1
Reversed 1
HGVS NC_000019.9:g.18717414_18717436del23
CLNSRC ClinVar GeneReviews
CLNACC RCV000020616.1,