Have questions? Visit https://www.reddit.com/r/SNPedia

rs137854905

From SNPedia

[PMID 24453034] Association study of SNPs of genes IFNGR1 (rs137854905), GSTT1 (rs71748309), and GSTP1 (rs1695) in gastric cancer development in samples of patient in the northern and northeastern Brazil

ClinVar
Risk rs137854905(TGTTCTGAGAGTGATCACTCCAGAAAT;TGTTCTGAGAGTGATCACTCCAGAAAT)
Alt rs137854905(TGTTCTGAGAGTGATCACTCCAGAAAT;TGTTCTGAGAGTGATCACTCCAGAAAT)
Reference rs137854905(;)
Significance Untested
Disease not provided
Variation info
Gene IFNGR1
CLNDBN not provided
Reversed 1
HGVS NC_000006.11:g.137519408_137519434dup27
CLNSRC ClinVar
CLNACC RCV000097411.1,