Have questions? Visit https://www.reddit.com/r/SNPedia

rs193302859

From SNPedia

ClinVar
Risk
Alt
Reference Rs193302859(GAGGATGCTGGCTACTTAAAGACCCCAG;GAGGATGCTGGCTACTTAAAGACCCCAG)
Significance Pathogenic
Disease Mucolipidosis III Gamma
Variation info
Gene GNPTG
CLNDBN Mucolipidosis III Gamma
Reversed 0
HGVS NC_000016.9:g.1412642_1412669del28
CLNSRC OMIM Allelic Variant
CLNACC RCV000002930.3,