Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922372

From SNPedia

rs193922372, also known as c.1077-69_1143del136, represents a rare deletion variant in the MSH2 gene on chromosome 2.

ClinVar
Risk rs193922372(A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT;A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT)
"rs193922372(A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT;A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT)" cannot be used as a page name in this wiki.
Alt rs193922372(A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT;A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT)
"rs193922372(A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT;A,ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT)" cannot be used as a page name in this wiki.
Reference rs193922372(CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT;CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT)
"rs193922372(CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT;CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT)" cannot be used as a page name in this wiki.
Significance Probable-Pathogenic
Disease Lynch syndrome
Variation info
Gene MSH2
CLNDBN Lynch syndrome
Reversed 0
HGVS NC_000002.11:g.47656812_47656947del136
CLNSRC ClinVar
CLNACC RCV000030236.1,