Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922372(-;-)

From SNPedia

double deletion (mutation); Lynch syndrome? but see warning
Is agenotype
ofrs193922372
GeneMSH2
Chromosome2
Position47,429,673
mentionedby
Magnitude3
ReputeBad
Geno Mag Summary
(-;-) 3 double deletion (mutation); Lynch syndrome? but see warning
(-;CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT) 6 Lynch syndrome mutation (reported)
(ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT;ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT) 0 common in clinvar

due to the unusual nature of this deletion mutation (being quite large for an entry in dbSNP), and since double mutations are so rare as to be ~unheard of, be extra cautious in any interpretation of this genotype