Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922372(-;CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT)

From SNPedia

Lynch syndrome mutation (reported)
Is agenotype
ofrs193922372
GeneMSH2
Chromosome2
Position47,429,673
mentionedby
Magnitude6
ReputeBad
Geno Mag Summary
(-;-) 3 double deletion (mutation); Lynch syndrome? but see warning
(-;CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT) 6 Lynch syndrome mutation (reported)
(ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT;ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT) 0 common in clinvar

Listed in ClinVar as likely pathogenic for Lynch syndrome