Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922372(ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT;ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT)

From SNPedia

common in clinvar
Is agenotype
ofrs193922372
GeneMSH2
Chromosome2
Position47,429,673
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;-) 3 double deletion (mutation); Lynch syndrome? but see warning
(-;CGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGATGCAGAATTGAGGCAGACTTTACAAGAAGATTTACTT) 6 Lynch syndrome mutation (reported)
(ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT;ACGTGCTTAGTTGATAAATTTTAATTTTATACTAAAATATTTTACATTAATTCAAGTTAATTTATTTCAGATTGAATTTAGTGGAAGCTTTTGTAGAAGAT) 0 common in clinvar