Have questions? Visit https://www.reddit.com/r/SNPedia

rs193922856

From SNPedia

ClinVar
Risk rs193922856(;)
Alt rs193922856(;)
Reference rs193922856(CTGGGCAGCAGTGACGCGCG;CTGGGCAGCAGTGACGCGCG)
Significance Pathogenic
Disease Neuromuscular disease not provided
Variation info
Gene RYR1
CLNDBN Neuromuscular disease, congenital, with uniform type 1 fiber not provided
Reversed 0
HGVS NC_000019.9:g.39055987_39056006del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000013870.24, RCV000119472.1,


[PMID 17538032] Congenital neuromuscular disease with uniform type 1 fiber and RYR1 mutation.