Have questions? Visit https://www.reddit.com/r/SNPedia

rs199422264

From SNPedia

ClinVar
Risk
Alt
Reference Rs199422264(TAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTC;TAACTGAGAAGGGCGTAGGCGCCGTGCTTTTGCTC)
Significance Pathogenic
Disease Dyskeratosis congenita autosomal dominant
Variation info
Gene TERC
CLNDBN Dyskeratosis congenita autosomal dominant
Reversed 1
HGVS NC_000003.11:g.169482762_169482796del35
CLNSRC ClinVar GeneReviews
CLNACC RCV000032579.1,