Have questions? Visit https://www.reddit.com/r/SNPedia

rs199473683

From SNPedia

ClinVar
Risk rs199473683(;)
Alt rs199473683(;)
Reference rs199473683(TTGTCCTGCCTTTCTATCCGA;TTGTCCTGCCTTTCTATCCGA)
Significance Pathogenic
Disease Cerebroretinal microangiopathy with calcifications and cysts
Variation info
Gene CTC1
CLNDBN Cerebroretinal microangiopathy with calcifications and cysts
Reversed 1
HGVS NC_000017.10:g.8131546_8131566del21
CLNSRC
CLNACC


[PMID 22387016OA-icon.png] Mutations in CTC1, encoding the CTS telomere maintenance complex component 1, cause cerebroretinal microangiopathy with calcifications and cysts.