Have questions? Visit https://www.reddit.com/r/SNPedia

rs199473693

From SNPedia

ClinVar
Risk rs199473693(;)
Alt rs199473693(;)
Reference rs199473693(CAGAGCCCAGGCCTCTGGCA;CAGAGCCCAGGCCTCTGGCA)
Significance Pathogenic
Disease Ectopia lentis et pupillae Ectopia lentis
Variation info
Gene LOC100289061 ADAMTSL4
CLNDBN Ectopia lentis et pupillae Ectopia lentis, isolated autosomal recessive
Reversed 0
HGVS NC_000001.10:g.150526234_150526253del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000032753.3, RCV000032754.4,