Have questions? Visit https://www.reddit.com/r/SNPedia

rs199474368

From SNPedia

ClinVar
Risk rs199474368(TCATCGCCGTGGGCAGCCCCGCT;TCATCGCCGTGGGCAGCCCCGCT)
Alt rs199474368(TCATCGCCGTGGGCAGCCCCGCT;TCATCGCCGTGGGCAGCCCCGCT)
Reference rs199474368(;)
Significance Histocompatibility
Disease
Variation info
Gene
CLNDBN
Reversed 0
HGVS NC_000006.11:g.29910596_29910597insTCATCGCCGTGGGCAGCCCCGCT
CLNSRC
CLNACC