Have questions? Visit https://www.reddit.com/r/SNPedia

rs199474405

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(;) 0 common in clinvar
Make rs199474405(-;-)
Make rs199474405(-;AGAGGATGGAGCCGCGGGCG)
Make rs199474405(AGAGGATGGAGCCGCGGGCG;AGAGGATGGAGCCGCGGGCG)
ReferenceGRCh37.p5 37.3/137
Chromosome6
Position29910679
GeneHLA-A
is asnp
is mentioned by
dbSNPrs199474405
ebirs199474405
HLIrs199474405
Exacrs199474405
Varsomers199474405
Maprs199474405
PheGenIrs199474405
hapmaprs199474405
1000 genomesrs199474405
hgdprs199474405
ensemblrs199474405
gopubmedrs199474405
geneviewrs199474405
scholarrs199474405
googlers199474405
pharmgkbrs199474405
gwascentralrs199474405
openSNPrs199474405
23andMers199474405
23andMe allrs199474405
SNP Nexus

SNPshotrs199474405
SNPdbers199474405
MSV3drs199474405
GWAS Ctlgrs199474405
StatusDeleted
Max Magnitude0
ClinVar
Risk rs199474405(AGAGGATGGAGCCGCGGGCG;AGAGGATGGAGCCGCGGGCG)
Alt rs199474405(AGAGGATGGAGCCGCGGGCG;AGAGGATGGAGCCGCGGGCG)
Reference rs199474405(;)
Significance Histocompatibility
Disease
Variation info
Gene
CLNDBN
Reversed 0
HGVS NC_000006.11:g.29910679_29910680insAGAGGATGGAGCCGCGGGCG
CLNSRC
CLNACC