Have questions? Visit https://www.reddit.com/r/SNPedia

rs199475570

From SNPedia

ClinVar
Risk rs199475570(;)
Alt rs199475570(;)
Reference rs199475570(AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG;AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG)
"rs199475570(AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG;AGAATGATGTAAACCTGACCCACATTGAATCTAGACCTTCTCGTTTAAAGAAAGATGAGTATGAATTTTTCACCCATTTGGATAAACGTAGCCTGCCTGCTCTGACAAACATCATCAAGATCTTGAGGCATGACATTGGTGCCACTGTCCATGAGCTTTCACGAGATAAGAAGAAAGACACAGG)" cannot be used as a page name in this wiki.
Significance Pathogenic
Disease Phenylketonuria not provided
Variation info
Gene PAH
CLNDBN Phenylketonuria not provided
Reversed 1
HGVS NC_000012.12:g.102894735_102894918del184
CLNSRC OMIM Allelic Variant
CLNACC RCV000000615.3, RCV000088856.1,