Have questions? Visit https://www.reddit.com/r/SNPedia

rs199475697

From SNPedia

Orientationminus
Geno Mag Summary
(-;22) 3 Carrier of a phenylketonuria mutation
(TATAAAACCCATGCTTGCTATG;TATAAAACCCATGCTTGCTATG) 0 common in clinvar
Make rs199475697(-;-)
Make rs199475697(-;TATAAAACCCATGCTTGCTATG)
ReferenceGRCh38.p2 38.2/147
Chromosome12
Position102855229
GenePAH
is asnp
is mentioned by
dbSNPrs199475697
ebirs199475697
HLIrs199475697
Exacrs199475697
Varsomers199475697
Maprs199475697
PheGenIrs199475697
hapmaprs199475697
1000 genomesrs199475697
hgdprs199475697
ensemblrs199475697
gopubmedrs199475697
geneviewrs199475697
scholarrs199475697
googlers199475697
pharmgkbrs199475697
gwascentralrs199475697
openSNPrs199475697
23andMers199475697
23andMe allrs199475697
SNP Nexus

SNPshotrs199475697
SNPdbers199475697
MSV3drs199475697
GWAS Ctlgrs199475697
Max Magnitude3
ClinVar
Risk rs199475697(;)
Alt rs199475697(;)
Reference rs199475697(TATAAAACCCATGCTTGCTATG;TATAAAACCCATGCTTGCTATG)
Significance Untested
Disease not provided
Variation info
Gene PAH
CLNDBN not provided
Reversed 1
HGVS NC_000012.11:g.103249007_103249028del22
CLNSRC
CLNACC RCV000088995.1,