Have questions? Visit https://www.reddit.com/r/SNPedia

rs267607475

From SNPedia

ClinVar
Risk rs267607475(;)
Alt rs267607475(;)
Reference rs267607475(ATCGCCACCTACCGCAAGCTGCTGGAG;ATCGCCACCTACCGCAAGCTGCTGGAG)
Significance Pathogenic
Disease not provided Palmoplantar keratoderma
Variation info
Gene KRT6C
CLNDBN not provided Palmoplantar keratoderma, nonepidermolytic, focal
Reversed 1
HGVS NC_000012.11:g.52863468_52863494del27
CLNSRC OMIM Allelic Variant
CLNACC RCV000057499.1, RCV000114417.2,