Have questions? Visit https://www.reddit.com/r/SNPedia

rs267607746

From SNPedia

ClinVar
Risk rs267607746(T;T)
Alt rs267607746(T;T)
Reference rs267607746(GCAAGTTACTCAGATGGAAAA;GCAAGTTACTCAGATGGAAAA)
Significance Pathogenic
Disease Lynch syndrome
Variation info
Gene MLH1
CLNDBN Lynch syndrome
Reversed 0
HGVS NC_000003.11:g.37048483_37048503del21insT
CLNSRC International Society for Gastrointestinal Hereditary Tumours
CLNACC RCV000075688.2,