Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608327

From SNPedia

ClinVar
Risk rs267608327(;)
Alt rs267608327(;)
Reference rs267608327(TGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC;TGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAGGACCCC)
Significance Pathogenic
Disease not provided Rett syndrome Mental retardation Autism
Variation info
Gene MECP2
CLNDBN not provided Rett syndrome Mental retardation, X-linked, syndromic 13 Autism, susceptibility to, X-linked 3
Reversed 1
HGVS NC_000023.10:g.153296082_153296122del41
CLNSRC
CLNACC RCV000132895.2, RCV000168701.4, RCV000169930.1, RCV000170099.1,