Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608519

From SNPedia

ClinVar
Risk rs267608519(;)
Alt rs267608519(;)
Reference rs267608519(TCATGGTGATCAAACGCCCCGGCAGG;TCATGGTGATCAAACGCCCCGGCAGG)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296520_153296545del26
CLNSRC
CLNACC RCV000133213.2,