Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608540

From SNPedia

ClinVar
Risk rs267608540(;)
Alt rs267608540(;)
Reference rs267608540(GATCTGTGCAGGAGACCGTACT;GATCTGTGCAGGAGACCGTACT)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296377_153296398del22
CLNSRC
CLNACC RCV000133267.2,