Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608567

From SNPedia

ClinVar
Risk rs267608567(;)
Alt rs267608567(;)
Reference rs267608567(CACCACCATCACCACCACTC;CACCACCATCACCACCACTC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296161_153296180del20
CLNSRC
CLNACC RCV000132854.2,