Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608580

From SNPedia

ClinVar
Risk
Alt
Reference Rs267608580(CCTGCCCCCACCTCCACCTGAGCCCGAGA;CCTGCCCCCACCTCCACCTGAGCCCGAGA)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296096_153296124del29
CLNSRC
CLNACC RCV000132885.2,