Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608585

From SNPedia

ClinVar
Risk rs267608585(;)
Alt rs267608585(;)
Reference rs267608585(TGCCCCCACCTCCACCTGAGCCCGAGAGCTCC;TGCCCCCACCTCCACCTGAGCCCGAGAGCTCC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296091_153296122del32
CLNSRC
CLNACC RCV000168702.2,