Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608586

From SNPedia

ClinVar
Risk
Alt
Reference Rs267608586(TGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG;TGCCCCCACCTCCACCTGAGCCCGAGAGCTCCGAG)
Significance Pathogenic
Disease not provided
Variation info
Gene MECP2
CLNDBN not provided
Reversed 1
HGVS NC_000023.10:g.153296088_153296122del35
CLNSRC
CLNACC RCV000132893.2,