Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608591

From SNPedia

ClinVar
Risk rs267608591(;)
Alt rs267608591(;)
Reference rs267608591(CCCCACCTCCACCTGAGCCCGAGAGC;CCCCACCTCCACCTGAGCCCGAGAGC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296094_153296119del26
CLNSRC
CLNACC RCV000132911.2,