Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608593

From SNPedia

ClinVar
Risk rs267608593(;)
Alt rs267608593(;)
Reference rs267608593(CCCCACCTCCACCTGAGCCCGAGAGCTCC;CCCCACCTCCACCTGAGCCCGAGAGCTCC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296091_153296119del29
CLNSRC
CLNACC RCV000132912.2,