Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608600

From SNPedia

ClinVar
Risk rs267608600(;)
Alt rs267608600(;)
Reference rs267608600(CACCTCCACCTGAGCCCGAGAGCTCC;CACCTCCACCTGAGCCCGAGAGCTCC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296091_153296116del26
CLNSRC
CLNACC RCV000132927.3,