Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608607

From SNPedia

ClinVar
Risk rs267608607(;)
Alt rs267608607(;)
Reference rs267608607(CCTCCACCTGAGCCCGAGAGCTCCGA;CCTCCACCTGAGCCCGAGAGCTCCGA)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296089_153296114del26
CLNSRC
CLNACC RCV000132935.2,