Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608617

From SNPedia

ClinVar
Risk rs267608617(;)
Alt rs267608617(;)
Reference rs267608617(TCTGCAAAGAGGAGAAGATGCCCAGA;TCTGCAAAGAGGAGAAGATGCCCAGA)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296019_153296044del26
CLNSRC
CLNACC RCV000132974.2,