Have questions? Visit https://www.reddit.com/r/SNPedia

rs267608637

From SNPedia

ClinVar
Risk rs267608637(;)
Alt rs267608637(;)
Reference rs267608637(AGAGTTAGCTGACTTTACACGGAG;AGAGTTAGCTGACTTTACACGGAG)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153295806_153295829del24
CLNSRC
CLNACC RCV000133012.2,