Have questions? Visit https://www.reddit.com/r/SNPedia

rs273900724

From SNPedia

ClinVar
Risk rs273900724(A;A)
Alt rs273900724(A;A)
Reference rs273900724(TAAAAAGCGTGTGTGTGTGTG;TAAAAAGCGTGTGTGTGTGTG)
Significance Pathogenic
Disease Breast-ovarian cancer Familial cancer of breast Tumor susceptibility linked to germline BAP1 mutations
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1 Familial cancer of breast Tumor susceptibility linked to germline BAP1 mutations
Reversed 1
HGVS NC_000017.10:g.41242939_41242959del21insT
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000031155.4, RCV000048475.2, RCV000215384.1,