rs273900724

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(A;TAAAAAGCGTGTGTGTGTGTG) 6 BRCA1 variant considered pathogenic for breast cancer
(TAAAAAGCGTGTGTGTGTGTG;TAAAAAGCGTGTGTGTGTGTG) 0 common in clinvar


Make rs273900724(A;A)
ReferenceGRCh38 38.1/141
Chromosome17
Position43090922
GeneBRCA1
is asnp
is mentioned by
dbSNPrs273900724
ebirs273900724
HLIrs273900724
Exacrs273900724
Varsomers273900724
Maprs273900724
PheGenIrs273900724
hapmaprs273900724
1000 genomesrs273900724
hgdprs273900724
ensemblrs273900724
gopubmedrs273900724
geneviewrs273900724
scholarrs273900724
googlers273900724
pharmgkbrs273900724
gwascentralrs273900724
openSNPrs273900724
23andMers273900724
23andMe allrs273900724
SNP Nexus

SNPshotrs273900724
SNPdbers273900724
MSV3drs273900724
GWAS Ctlgrs273900724
Max Magnitude6
ClinVar
Risk rs273900724(A;A)
Alt rs273900724(A;A)
Reference Rs273900724(TAAAAAGCGTGTGTGTGTGTG;TAAAAAGCGTGTGTGTGTGTG)
Significance Pathogenic
Disease Breast-ovarian cancer Familial cancer of breast Hereditary cancer-predisposing syndrome
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1 Familial cancer of breast Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.41242939_41242959del21insT
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000031155.4, RCV000048475.2, RCV000215384.1,