Have questions? Visit https://www.reddit.com/r/SNPedia

rs273901753

From SNPedia

rs273901753, also known as 5328del40insTC, c.5209_5248delinsTC and p.Arg1737_Lys1750?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs273901753(TC;TC)
Alt rs273901753(TC;TC)
Reference rs273901753(AGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAA;AGAGGAGATGTGGTCAATGGAAGAAACCACCAAGGTCCAA)
Significance Pathogenic
Disease Familial cancer of breast Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41209098_41209137del40insGA
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000048861.2, RCV000112565.1,