Have questions? Visit https://www.reddit.com/r/SNPedia

rs281874736

From SNPedia

ClinVar
Risk rs281874736(GGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCA;GGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCA)
Alt rs281874736(GGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCA;GGTCCCCCTGGTCCAGATGGATTGCAAGGTCCCCCA)
Reference rs281874736(;)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107930729_107930764dup36
CLNSRC ClinVar
CLNACC RCV000021607.1,


[PMID 8651296OA-icon.png] X-linked Alport syndrome: an SSCP-based mutation survey over all 51 exons of the COL4A5 gene.