Have questions? Visit https://www.reddit.com/r/SNPedia

rs281874744

From SNPedia

ClinVar
Risk rs281874744(CA;CA)
Alt rs281874744(CA;CA)
Reference rs281874744(ATTATGTTCCTTCTCCTTTTCC;ATTATGTTCCTTCTCCTTTTCC)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107938007_107938028del22insCA
CLNSRC ClinVar
CLNACC RCV000021637.1,


[PMID 20378821OA-icon.png] Genotype-phenotype correlation in X-linked Alport syndrome.